ID: 1143237895_1143237906

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1143237895 1143237906
Species Human (GRCh38) Human (GRCh38)
Location 17:5419160-5419182 17:5419207-5419229
Sequence CCCTTTCCTTCCTCCCAGGCCTC TGAGTCCCCGCGACCGCGTATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 149, 4: 1100} {0: 1, 1: 0, 2: 0, 3: 1, 4: 8}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!