ID: 1143241168_1143241174

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1143241168 1143241174
Species Human (GRCh38) Human (GRCh38)
Location 17:5444456-5444478 17:5444500-5444522
Sequence CCAGGCAGCGGCGGACACTCTCC ATTGGCATTGACATCTGTTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 130} {0: 1, 1: 0, 2: 2, 3: 18, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!