ID: 1143241213_1143241216

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1143241213 1143241216
Species Human (GRCh38) Human (GRCh38)
Location 17:5444715-5444737 17:5444728-5444750
Sequence CCAGAAACAGGGAAACTACCGCC AACTACCGCCTGTGAAGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48} {0: 1, 1: 0, 2: 1, 3: 3, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!