ID: 1143241213_1143241222

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1143241213 1143241222
Species Human (GRCh38) Human (GRCh38)
Location 17:5444715-5444737 17:5444737-5444759
Sequence CCAGAAACAGGGAAACTACCGCC CTGTGAAGGTAGGGCTGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48} {0: 1, 1: 0, 2: 0, 3: 48, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!