ID: 1143243358_1143243365

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1143243358 1143243365
Species Human (GRCh38) Human (GRCh38)
Location 17:5462764-5462786 17:5462790-5462812
Sequence CCTTCTACCTCAAGCTATTTAAT TTCATGTGGGCCGGGTGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 190} {0: 1, 1: 5, 2: 70, 3: 615, 4: 3447}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!