ID: 1143258789_1143258798

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1143258789 1143258798
Species Human (GRCh38) Human (GRCh38)
Location 17:5583539-5583561 17:5583575-5583597
Sequence CCTGGATCCCCCTTTGAGAGGGC TGCTCAGAGGAAGGCCTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74} {0: 1, 1: 0, 2: 9, 3: 35, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!