ID: 1143276009_1143276015

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1143276009 1143276015
Species Human (GRCh38) Human (GRCh38)
Location 17:5711395-5711417 17:5711411-5711433
Sequence CCCACCTACCTCTGGAAAGACAC AAGACACTGGAGTCTTGGAGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 60, 4: 418}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!