ID: 1143286853_1143286859

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1143286853 1143286859
Species Human (GRCh38) Human (GRCh38)
Location 17:5796542-5796564 17:5796564-5796586
Sequence CCAACTTCCTTACATTCTCACCT TGGTGTTATTACTTGGGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 60, 4: 755} {0: 1, 1: 0, 2: 2, 3: 9, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!