ID: 1143310900_1143310904

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1143310900 1143310904
Species Human (GRCh38) Human (GRCh38)
Location 17:5988065-5988087 17:5988096-5988118
Sequence CCTTCTGTCACGATTGGAAATTT CTCAACCAGAAGTAGATGCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 42, 3: 672, 4: 4656} {0: 1, 1: 0, 2: 0, 3: 4, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!