ID: 1143351592_1143351601

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1143351592 1143351601
Species Human (GRCh38) Human (GRCh38)
Location 17:6291985-6292007 17:6292022-6292044
Sequence CCCCCAAAATAAGCAACTCCTTA GGTGCCTCACTCACTTCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 253} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!