ID: 1143367433_1143367435

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1143367433 1143367435
Species Human (GRCh38) Human (GRCh38)
Location 17:6417306-6417328 17:6417323-6417345
Sequence CCTCAAGCGGGAGAGGAATGGAG ATGGAGAAAGAGGCTGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 225} {0: 1, 1: 0, 2: 11, 3: 122, 4: 1087}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!