ID: 1143367853_1143367857

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1143367853 1143367857
Species Human (GRCh38) Human (GRCh38)
Location 17:6420176-6420198 17:6420190-6420212
Sequence CCTCCTCGGCTCTCCTCTGCTCC CTCTGCTCCCTGCATCCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 78, 4: 827} {0: 1, 1: 0, 2: 5, 3: 98, 4: 616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!