ID: 1143373320_1143373336

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1143373320 1143373336
Species Human (GRCh38) Human (GRCh38)
Location 17:6453866-6453888 17:6453904-6453926
Sequence CCACGTGGGCAGCCCCACACAGC CCAGGGAGTCGGGGTTTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 196} {0: 1, 1: 0, 2: 1, 3: 21, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!