ID: 1143381790_1143381792

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1143381790 1143381792
Species Human (GRCh38) Human (GRCh38)
Location 17:6501265-6501287 17:6501290-6501312
Sequence CCTATATTCATCATGCTTGTTAT TATAATGTTTTGACATCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 272} {0: 1, 1: 2, 2: 6, 3: 37, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!