ID: 1143393885_1143393890

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1143393885 1143393890
Species Human (GRCh38) Human (GRCh38)
Location 17:6576704-6576726 17:6576718-6576740
Sequence CCTTCCTCTTGCTGTTGGCCCTG TTGGCCCTGGGGCTTCCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 39, 4: 393} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!