ID: 1143411322_1143411336

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1143411322 1143411336
Species Human (GRCh38) Human (GRCh38)
Location 17:6711184-6711206 17:6711218-6711240
Sequence CCCTGCCCGTGCTGTGTACCCTC GCACAATGGGGCGGCCATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 164} {0: 1, 1: 0, 2: 1, 3: 25, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!