ID: 1143411322_1143411342

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1143411322 1143411342
Species Human (GRCh38) Human (GRCh38)
Location 17:6711184-6711206 17:6711229-6711251
Sequence CCCTGCCCGTGCTGTGTACCCTC CGGCCATGGAGGGTGGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 164} {0: 1, 1: 0, 2: 13, 3: 67, 4: 633}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!