ID: 1143417084_1143417095

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1143417084 1143417095
Species Human (GRCh38) Human (GRCh38)
Location 17:6758179-6758201 17:6758222-6758244
Sequence CCCCAAGGAAACCATGGAGGAGC CAGGTGAGGAGGCGGCAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 156} {0: 1, 1: 0, 2: 5, 3: 103, 4: 941}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!