ID: 1143417084_1143417096

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1143417084 1143417096
Species Human (GRCh38) Human (GRCh38)
Location 17:6758179-6758201 17:6758226-6758248
Sequence CCCCAAGGAAACCATGGAGGAGC TGAGGAGGCGGCAGGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 156} {0: 1, 1: 1, 2: 17, 3: 178, 4: 2206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!