ID: 1143420661_1143420667

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1143420661 1143420667
Species Human (GRCh38) Human (GRCh38)
Location 17:6789150-6789172 17:6789202-6789224
Sequence CCTTTATTTTTCCACAAATATGC ATGTGAATGGCCAAGTTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 33, 4: 426} {0: 1, 1: 0, 2: 0, 3: 8, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!