ID: 1143423312_1143423320

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1143423312 1143423320
Species Human (GRCh38) Human (GRCh38)
Location 17:6813040-6813062 17:6813081-6813103
Sequence CCAGACTCACGGAGCTGAAACAG CAGCATATTTGGGGTGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101} {0: 1, 1: 1, 2: 11, 3: 55, 4: 442}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!