ID: 1143434491_1143434496

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1143434491 1143434496
Species Human (GRCh38) Human (GRCh38)
Location 17:6913836-6913858 17:6913868-6913890
Sequence CCAGAGTGTGAGAGGGGAAGAGT TGGGATACACACCCCCACCAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 12, 3: 57, 4: 299} {0: 4, 1: 1, 2: 10, 3: 25, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!