ID: 1143439398_1143439413

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1143439398 1143439413
Species Human (GRCh38) Human (GRCh38)
Location 17:6957447-6957469 17:6957483-6957505
Sequence CCACTAAACCCCCGCAGAACCTG CTGGGAGGTTCAATGTGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 109} {0: 1, 1: 0, 2: 1, 3: 11, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!