ID: 1143446819_1143446830

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1143446819 1143446830
Species Human (GRCh38) Human (GRCh38)
Location 17:7014771-7014793 17:7014805-7014827
Sequence CCGAGCCGCTCAGTCTCCCTGCT CGGCTCGCGTGTAGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 277} {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!