ID: 1143446823_1143446832

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1143446823 1143446832
Species Human (GRCh38) Human (GRCh38)
Location 17:7014787-7014809 17:7014821-7014843
Sequence CCCTGCTCTCCGTGGTCCCGGCT GCGGCGGCGGCGTCTCCGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 143} {0: 1, 1: 0, 2: 4, 3: 29, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!