ID: 1143447009_1143447025

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1143447009 1143447025
Species Human (GRCh38) Human (GRCh38)
Location 17:7015591-7015613 17:7015642-7015664
Sequence CCCGGTTCCCGCAGGGCCTCAAG TCTTTATGCATCCGTGGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 141} {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!