ID: 1143448757_1143448767

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1143448757 1143448767
Species Human (GRCh38) Human (GRCh38)
Location 17:7023416-7023438 17:7023460-7023482
Sequence CCAACGACGCCGCGGTGTGGAAC GTGGGATCTGGAAGAGGCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 15} {0: 1, 1: 0, 2: 4, 3: 48, 4: 408}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!