ID: 1143449167_1143449170

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1143449167 1143449170
Species Human (GRCh38) Human (GRCh38)
Location 17:7025461-7025483 17:7025478-7025500
Sequence CCCTTTCAGAGCTGAATGGTCAG GGTCAGCCCAAAGCTTGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 152} {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!