ID: 1143451043_1143451050

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1143451043 1143451050
Species Human (GRCh38) Human (GRCh38)
Location 17:7036832-7036854 17:7036849-7036871
Sequence CCTTGACCCACCTATACCTGAGT CTGAGTATTGGGTTGCTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 297} {0: 1, 1: 0, 2: 1, 3: 7, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!