ID: 1143451043_1143451051

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1143451043 1143451051
Species Human (GRCh38) Human (GRCh38)
Location 17:7036832-7036854 17:7036866-7036888
Sequence CCTTGACCCACCTATACCTGAGT GTCAGGTGAGAGCCTGCACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 297} {0: 1, 1: 0, 2: 2, 3: 13, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!