ID: 1143481870_1143481873

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1143481870 1143481873
Species Human (GRCh38) Human (GRCh38)
Location 17:7231973-7231995 17:7232020-7232042
Sequence CCTCACTGGGCACAAAATTCTGC AGATCCCAAAGCCCAGCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 193} {0: 1, 1: 0, 2: 2, 3: 26, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!