ID: 1143510973_1143510988

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1143510973 1143510988
Species Human (GRCh38) Human (GRCh38)
Location 17:7394773-7394795 17:7394818-7394840
Sequence CCGCCAGGCCGGCGGCGTGCGTG GAGGGCGGCCCGGGCCGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 83} {0: 1, 1: 2, 2: 5, 3: 75, 4: 604}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!