ID: 1143514027_1143514036

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1143514027 1143514036
Species Human (GRCh38) Human (GRCh38)
Location 17:7410529-7410551 17:7410565-7410587
Sequence CCATCCCAGCACTCCCTACTCTC ACACCCCAGGGCCCCCTCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 88, 4: 640} {0: 1, 1: 0, 2: 0, 3: 13, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!