ID: 1143563097_1143563106

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1143563097 1143563106
Species Human (GRCh38) Human (GRCh38)
Location 17:7706568-7706590 17:7706614-7706636
Sequence CCCGCTCATAAAAGAGTTCTGTG GGGGAGACTGTGTGAGGCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 191} {0: 1, 1: 0, 2: 6, 3: 61, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!