ID: 1143589799_1143589805

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1143589799 1143589805
Species Human (GRCh38) Human (GRCh38)
Location 17:7875821-7875843 17:7875860-7875882
Sequence CCCTGAAACCTGCACAACCACAG TTCTGGACATTTCATATAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 238} {0: 330, 1: 1090, 2: 1783, 3: 2104, 4: 2074}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!