ID: 1143591647_1143591650

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1143591647 1143591650
Species Human (GRCh38) Human (GRCh38)
Location 17:7888685-7888707 17:7888700-7888722
Sequence CCATCCTCTGGATTTGTGGGCCT GTGGGCCTGAGAGTGTGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 201} {0: 1, 1: 0, 2: 6, 3: 78, 4: 677}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!