ID: 1143591647_1143591654

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1143591647 1143591654
Species Human (GRCh38) Human (GRCh38)
Location 17:7888685-7888707 17:7888738-7888760
Sequence CCATCCTCTGGATTTGTGGGCCT GCGCGCGCGTGCTTTTGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 201} {0: 1, 1: 1, 2: 1, 3: 4, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!