ID: 1143627864_1143627886

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1143627864 1143627886
Species Human (GRCh38) Human (GRCh38)
Location 17:8121546-8121568 17:8121582-8121604
Sequence CCCCGCCCCCACCACCCCCCAAG GTCTCCAGAAAGCGGGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 28, 3: 233, 4: 2325} {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!