ID: 1143628155_1143628163

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1143628155 1143628163
Species Human (GRCh38) Human (GRCh38)
Location 17:8122534-8122556 17:8122585-8122607
Sequence CCCGATCGCATTTGCGCACTGCC GAGATGACCAAGGAAAGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28} {0: 1, 1: 0, 2: 1, 3: 16, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!