ID: 1143633589_1143633604

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1143633589 1143633604
Species Human (GRCh38) Human (GRCh38)
Location 17:8152072-8152094 17:8152123-8152145
Sequence CCGCTGAGAGTCGGCTGTGGGGC CAAGCTGGAGGTAAGATGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 118} {0: 1, 1: 0, 2: 1, 3: 24, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!