ID: 1143666538_1143666548

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1143666538 1143666548
Species Human (GRCh38) Human (GRCh38)
Location 17:8365314-8365336 17:8365338-8365360
Sequence CCGGTATGCCAAGTAACTAGGAG GAGGAGGTCAGCACTGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107} {0: 1, 1: 0, 2: 5, 3: 54, 4: 600}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!