ID: 1143685610_1143685615

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1143685610 1143685615
Species Human (GRCh38) Human (GRCh38)
Location 17:8513192-8513214 17:8513208-8513230
Sequence CCATTTTTCTATTTCCCCTCATA CCTCATAAACAGACATAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 10, 3: 48, 4: 600} {0: 1, 1: 0, 2: 0, 3: 22, 4: 617}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!