ID: 1143690582_1143690585

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1143690582 1143690585
Species Human (GRCh38) Human (GRCh38)
Location 17:8561036-8561058 17:8561065-8561087
Sequence CCACTTGCTCACAATATCCTGTA GTGGTCTCACTGCAGTTCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 146} {0: 1, 1: 1, 2: 1, 3: 10, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!