ID: 1143725057_1143725063

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1143725057 1143725063
Species Human (GRCh38) Human (GRCh38)
Location 17:8838970-8838992 17:8838991-8839013
Sequence CCGAGCCACATTCTGGAAGTCCT CTGCAGGCCTGGAGTGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 209} {0: 1, 1: 0, 2: 7, 3: 56, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!