ID: 1143733713_1143733726

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1143733713 1143733726
Species Human (GRCh38) Human (GRCh38)
Location 17:8895946-8895968 17:8895978-8896000
Sequence CCCTTCCTTGGCCTCTCTTGGTA CCTGCTTAGCATGGGGTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 273} {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!