ID: 1143739991_1143739995

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1143739991 1143739995
Species Human (GRCh38) Human (GRCh38)
Location 17:8945428-8945450 17:8945459-8945481
Sequence CCTTGGCTACTCCTTCATAAGCG CTGGTGACCCAGAGAGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 76} {0: 1, 1: 0, 2: 5, 3: 37, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!