ID: 1143747215_1143747228

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1143747215 1143747228
Species Human (GRCh38) Human (GRCh38)
Location 17:9003407-9003429 17:9003452-9003474
Sequence CCCAGCCCCGCGTCCTGCGCACT CGGCGAGCCCCAGCCTGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 168} {0: 1, 1: 0, 2: 1, 3: 15, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!