ID: 1143752480_1143752488

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1143752480 1143752488
Species Human (GRCh38) Human (GRCh38)
Location 17:9038670-9038692 17:9038685-9038707
Sequence CCTCCTCCCACACACCTCATGAT CTCATGATCACTGGGGTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 25, 4: 337} {0: 1, 1: 0, 2: 1, 3: 9, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!