ID: 1143764044_1143764050

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1143764044 1143764050
Species Human (GRCh38) Human (GRCh38)
Location 17:9126031-9126053 17:9126046-9126068
Sequence CCCCAGCCAGCCTGATTGCAGAA TTGCAGAAGCAGAGTCAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 307} {0: 1, 1: 1, 2: 6, 3: 45, 4: 459}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!