ID: 1143764046_1143764050

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1143764046 1143764050
Species Human (GRCh38) Human (GRCh38)
Location 17:9126033-9126055 17:9126046-9126068
Sequence CCAGCCAGCCTGATTGCAGAAGC TTGCAGAAGCAGAGTCAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 223} {0: 1, 1: 1, 2: 6, 3: 45, 4: 459}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!